circad | circRNAs associated with diseases

hsa_circ_0000181
Gene	TATDN3	Organism	Human
Genome Locus	chr1:212977661-212981190:+	Build	hg19
Disease	Gastric Cancer	ICD-10	Stomach, Malignant neoplasm of unspecified (C16.9)
DBLink	Link to database	PMID	28940688
Experimental Method
Sample Type	Tissues	Comparison	115 fresh gastric cancer tissues and paired adjacent nontumorous tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GAACTGAATGGGCTTGCTATGAAA Reverse CAGCTGCACTGAGAACATCTCTGA	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Zhao, Q, Chen, S, Li, T, Xiao, B, Zhang, X (2018). Clinical values of circular RNA 0000181 in the screening of gastric cancer. J. Clin. Lab. Anal., 32, 4:e22333.